After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human BCL2 cDNA Clone Product Information
NCBI RefSeq:NM_000633.2
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha with N terminal His tag.
Gene Synonym:BCL2
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-BCL2
Restriction Site:KpnI + XbaI (6kb + 0.77kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BCL2 Gene Plasmid Map
Human Bcl-2 / BCL2 transcript variant alpha natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10195-ACG$225
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10195-ACR$225
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10195-ANG$225
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10195-ANR$225
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG10195-CF$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tagHG10195-CH$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Myc tagHG10195-CM$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-HA tagHG10195-CY$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG10195-M$75
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Flag tagHG10195-NF$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tagHG10195-NH$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Myc tagHG10195-NM$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-HA tagHG10195-NY$195
Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmidHG10195-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Size / Price
    Catalog: HG10195-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human Bcl-2 / BCL2 transcript variant alpha natural ORF mammalian expression plasmid, N-His tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"