Quick Order

Text Size:AAA

Human BUB1B natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BUB1B cDNA Clone Product Information
NCBI RefSeq:NM_001211.5
RefSeq ORF Size:3153bp
cDNA Description:Full length Clone DNA of Homo sapiens budding uninhibited by benzimidazoles 1 homolog beta (yeast).
Gene Synonym:SSK1, BUBR1, Bub1A, MAD3L, hBUBR1, BUB1beta, BUB1B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-BUB1B
Restriction Site:KpnI + PmeI (6.1kb + 3.15kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BUB1B Gene Plasmid Map
Human BUB1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10710-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"