Quick Order

Human BTNL3 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human BTNL3 cDNA Clone Product Information
    NCBI RefSeq:BC100801
    RefSeq ORF Size:1401bp
    cDNA Description:Full length Clone DNA of Homo sapiens butyrophilin-like 3 with C terminal HA tag.
    Gene Synonym:BTNLR
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BTNL3 qPCR primers for gene expression analysis, HP104360 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Butyrophilins (Btns) and butyrophilin-like (Btnl) molecules are emerging as novel regulators of immune responses in mice and humans.The human genome contains four identified BTNL genes, with the somewhat confusing designations of 2, 3, 8 and 9. BTNL2, the best charac- terised family member, is clustered with the BTN genes on chromosome 6, whereas the much less explored family members BTNL3, BTNL8 and BTNL9 are localised on chromosome 5.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Abeler-Dörner L, Swamy M, Williams G, et al. Butyrophilins: an emerging family of immune regulators[J]. Trends in immunology, 2012, 33(1): 34-41.
  • Size / Price
    Catalog: HG15769-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"