Text Size:AAA

Human BTN2A2 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human BTN2A2 cDNA Clone Product Information
NCBI RefSeq:BC017497
RefSeq ORF Size:1011bp
cDNA Description:Full length Clone DNA of Homo sapiens butyrophilin, subfamily 2, member A2 with C terminal His tag.
Gene Synonym:BTF2, BT2.2, BTN2A2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BTN2A2 qPCR primers for gene expression analysis, HP101970 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The human and mouse genes encoding butyrophilin-2A2 (BTN2A2) are regulated by the class II trans-activator and regulatory factor X, two transcription factors dedicated to major histocompatibility complex class II expression, suggesting a role in T cell immunity. To address this, Btn2a2-deficient mice are generated. Btn2a2−/− mice exhibited enhanced effector CD4+ and CD8+ T cell responses, impaired CD4+ regulatory T cell induction, potentiated antitumor responses, and exacerbated experimental autoimmune encephalomyelitis. Altered immune responses were attributed to Btn2a2 deficiency in antigen-presenting cells rather than T cells or nonhematopoietic cells. These results provide the first genetic evidence that BTN2A2 is a co-inhibitory molecule that modulates T cell–mediated immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Sarter K, Leimgruber E, Gobet F, et al. Btn2a2, a T cell immunomodulatory molecule coregulated with MHC class II genes. The Journal of Experimental Medicine. 2016;213(2):177-187.
  • Size / Price
    Catalog: HG13261-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"