BTN2A1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12233-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BTN2A1 Reagents
CRO Services
Product recommended

All BTN2A1 Reagents
BTN2A1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Human butyrophilin, subfamily 2, member A1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTN2A1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
BK14H9.1 cDNA ORF Clone, Human;BT2.1 cDNA ORF Clone, Human;BTF1 cDNA ORF Clone, Human;BTN2.1 cDNA ORF Clone, Human;DJ3E1.1 cDNA ORF Clone, Human
BTN2A1 Background Information

The MHC-encoded butyrophilin, BTN2A1, is a cell surface glycoprotein related to the extended family of B7 costimulatory molecules. BTN2A1 mRNA was expressed in most human tissues, but protein expression was significantly lower in leukocytes. An Ig-fusion protein of BTN2A1 bound to immature monocyte-derived dendritic cells. Binding diminished upon MoDC maturation and no binding was detected to Langerhans cells. Induction of the counterreceptor was IL-4 dependent and occurred early during dendritic cell differentiation. The interaction required the presence of Ca2+ and was mediated by high-mannose oligosaccharides. These properties matched DC-SIGN, a DC-specific HIV-1 entry receptor. This was confirmed by binding of soluble BTN2A1 to DC-SIGN-transfectants and its inhibition by a specific Ab. DC-SIGN bound to native BTN2A1 expressed on a range of tissues. However, BTN2A1 was not recognized on some normal cells such as HUVECs despite a similar expression level. The BTN2A1 of tumor cells such as HEK293T have more high-mannose moieties in comparison to HUVECs, and those high-mannose moieties are instrumental for binding to DC-SIGN

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
butyrophilin subfamily 2 member A1
References
  • Malcherek G, Mayr L, Roda-Navarro P, et al. The B7 homolog butyrophilin BTN2A1 is a novel ligand for DC-SIGN[J]. The Journal of Immunology, 2007, 179(6): 3804-3811.
  • info info
    添加购物车成功! 添加购物车失败!