BTBD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16355-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BTBD10 Reagents
CRO Services
Product recommended

All BTBD10 Reagents
BTBD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Human BTB (POZ) domain containing 10 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTBD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
GMRP-1 cDNA ORF Clone, Human;GMRP1 cDNA ORF Clone, Human
BTBD10 Background Information
Full Name
BTB (POZ) domain containing 10

BTBD10 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
BTBD10 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90616-G
BTBD10 cDNA ORF Clone, Cynomolgus, untagged CG90616-UT
BTBD10 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90616-ACG
BTBD10 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90616-ACGLN
BTBD10 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90616-ANG
BTBD10 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90616-ACR
BTBD10 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90616-ANR
BTBD10 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90616-CF
BTBD10 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90616-NF
BTBD10 cDNA ORF Clone, Cynomolgus, C-His tag CG90616-CH
BTBD10 cDNA ORF Clone, Cynomolgus, N-His tag CG90616-NH
BTBD10 cDNA ORF Clone, Cynomolgus, C-HA tag CG90616-CY
BTBD10 cDNA ORF Clone, Cynomolgus, N-HA tag CG90616-NY
BTBD10 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90616-CM
BTBD10 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90616-NM

BTBD10 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
BTBD10 cDNA ORF Clone in Cloning Vector, Rabbit TG65103-G
BTBD10 cDNA ORF Clone, Rabbit, untagged TG65103-UT
BTBD10 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65103-ACG
BTBD10 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65103-ANG
BTBD10 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65103-ACR
BTBD10 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65103-ANR
BTBD10 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65103-CF
BTBD10 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65103-NF
BTBD10 cDNA ORF Clone, Rabbit, C-His tag TG65103-CH
BTBD10 cDNA ORF Clone, Rabbit, N-His tag TG65103-NH
BTBD10 cDNA ORF Clone, Rabbit, C-HA tag TG65103-CY
BTBD10 cDNA ORF Clone, Rabbit, N-HA tag TG65103-NY
BTBD10 cDNA ORF Clone, Rabbit, C-Myc tag TG65103-CM
BTBD10 cDNA ORF Clone, Rabbit, N-Myc tag TG65103-NM

BTBD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BTBD10 cDNA ORF Clone in Cloning Vector, Mouse MG53377-U
BTBD10 cDNA ORF Clone, Mouse, untagged MG53377-UT
BTBD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53377-ACG
BTBD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53377-ACGLN
BTBD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53377-ANG
BTBD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53377-ACR
BTBD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53377-ANR
BTBD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53377-CF
BTBD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53377-NF
BTBD10 cDNA ORF Clone, Mouse, C-His tag MG53377-CH
BTBD10 cDNA ORF Clone, Mouse, N-His tag MG53377-NH
BTBD10 cDNA ORF Clone, Mouse, C-HA tag MG53377-CY
BTBD10 cDNA ORF Clone, Mouse, N-HA tag MG53377-NY
BTBD10 cDNA ORF Clone, Mouse, C-Myc tag MG53377-CM
BTBD10 cDNA ORF Clone, Mouse, N-Myc tag MG53377-NM

BTBD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BTBD10 cDNA ORF Clone in Cloning Vector, Human HG16355-G
BTBD10 cDNA ORF Clone in Cloning Vector, Human HG29641-U
BTBD10 cDNA ORF Clone, Human, untagged HG16355-UT
BTBD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29641-ACGLN
BTBD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16355-ACG
BTBD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16355-ACGLN
BTBD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG16355-ANG
BTBD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16355-ACR
BTBD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG16355-ANR
BTBD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16355-NF
BTBD10 cDNA ORF Clone, Human, C-His tag HG16355-CH
BTBD10 cDNA ORF Clone, Human, N-His tag HG16355-NH
BTBD10 cDNA ORF Clone, Human, C-HA tag HG16355-CY
BTBD10 cDNA ORF Clone, Human, N-HA tag HG16355-NY
BTBD10 cDNA ORF Clone, Human, C-Myc tag HG16355-CM
BTBD10 cDNA ORF Clone, Human, N-Myc tag HG16355-NM
BTBD10 qPCR Primer Pairs, Human HP105107
info info
添加购物车成功! 添加购物车失败!