BSCL2 cDNA ORF Clone, Human, C-HA tag

Cat: HG14081-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BSCL2 Reagents
CRO Services
Product recommended

All BSCL2 Reagents
BSCL2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Human Berardinelli-Seip congenital lipodystrophy 2 (seipin) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BSCL2 cDNA ORF Clone, Human, C-HA tag Alternative Names
GNG3LG cDNA ORF Clone, Human;HMN5 cDNA ORF Clone, Human;PELD cDNA ORF Clone, Human;SPG17 cDNA ORF Clone, Human
BSCL2 Background Information
Full Name
Berardinelli-Seip congenital lipodystrophy 2 (seipin)

BSCL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Rat RG85008-U
BSCL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85008-ACGLN

BSCL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Mouse MG52738-G
BSCL2 cDNA ORF Clone, Mouse, untagged MG52738-UT
BSCL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52738-ACGLN
BSCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52738-ACG
BSCL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52738-ACR
BSCL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52738-CF
BSCL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52738-NF
BSCL2 cDNA ORF Clone, Mouse, C-His tag MG52738-CH
BSCL2 cDNA ORF Clone, Mouse, N-His tag MG52738-NH
BSCL2 cDNA ORF Clone, Mouse, C-HA tag MG52738-CY
BSCL2 cDNA ORF Clone, Mouse, N-HA tag MG52738-NY
BSCL2 cDNA ORF Clone, Mouse, C-Myc tag MG52738-CM
BSCL2 cDNA ORF Clone, Mouse, N-Myc tag MG52738-NM
BSCL2 qPCR Primer Pairs, Mouse MP202609

BSCL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Human HG14081-G
BSCL2 cDNA ORF Clone, Human, untagged HG14081-UT
BSCL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14081-ACGLN
BSCL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14081-ACG
BSCL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14081-ACR
BSCL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14081-CF
BSCL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14081-NF
BSCL2 cDNA ORF Clone, Human, C-His tag HG14081-CH
BSCL2 cDNA ORF Clone, Human, N-His tag HG14081-NH
BSCL2 cDNA ORF Clone, Human, N-HA tag HG14081-NY
BSCL2 cDNA ORF Clone, Human, C-Myc tag HG14081-CM
BSCL2 cDNA ORF Clone, Human, N-Myc tag HG14081-NM
BSCL2 qPCR Primer Pairs, Human HP102735
info info
添加购物车成功! 添加购物车失败!