BRDT cDNA ORF Clone, Human, N-Myc tag

Cat: HG11602-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BRDT Reagents
CRO Services
Product recommended

All BRDT Reagents
BRDT cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2844 bp
Description
Full length Clone DNA of Human bromodomain, testis-specific with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRDT cDNA ORF Clone, Human, N-Myc tag Alternative Names
BRD6 cDNA ORF Clone, Human;CT9 cDNA ORF Clone, Human
BRDT Background Information

The BRDT gene and its transcripts (bromodomain testis-specific gene, also referred to as FSRG3 or BRD6) represent potential candidates for studying the role of epigenetic changes for fertility and paternal contribution to the embryo, as they play an important role in the establishment of proper germ cell differentiation. The first bromodomain of the BRDT protein recognises the acetylation marks of histone 4 in order to start chromatin remodelling. In addition, male mice carrying a mutation within the allele of the first bromodomain are subfertile. BRDT transcripts have been demonstrated to be specifically expressed in human and murine testis. In the latter, Brdt mRNA has been observed from pachytene spermatocytes to spermatids. In man, a splicing variant of the BRDT gene (BRDT-NY) was found in embryonic and adult human testis and spermatozoa from fertile men. By contrast, transcripts of this splicing variant could not be detected in testis of some azoospermic men including arrest of spermatogenesis at the level of round spermatids. As spermatozoa are known to contain a variety of transcripts and mRNAs could be delivered from sperm to oocyte, it might be possible that BRDT mRNA influences chromatin compaction during spermiogenesis and/or expression of BRDT during early embryogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
bromodomain, testis-specific
References
  • Steilmann C, Cavalcanti M C O, Bartkuhn M, et al. The interaction of modified histones with the bromodomain testis-specific (BRDT) gene and its mRNA level in sperm of fertile donors and subfertile men[J]. Reproduction, 2010, 140(3): 435-443.
  • info info
    添加购物车成功! 添加购物车失败!