Text Size:AAA

Human BRDT Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human BRDT cDNA Clone Product Information
    NCBI RefSeq:NM_001726.3
    RefSeq ORF Size:2844bp
    cDNA Description:Full length Clone DNA of Homo sapiens bromodomain, testis-specific with C terminal His tag.
    Gene Synonym:CT9, BRD6, BRDT
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BRDT qPCR primers for gene expression analysis, HP101463 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    The BRDT gene and its transcripts (bromodomain testis-specific gene, also referred to as FSRG3 or BRD6) represent potential candidates for studying the role of epigenetic changes for fertility and paternal contribution to the embryo, as they play an important role in the establishment of proper germ cell differentiation. The first bromodomain of the BRDT protein recognises the acetylation marks of histone 4 in order to start chromatin remodelling. In addition, male mice carrying a mutation within the allele of the first bromodomain are subfertile. BRDT transcripts have been demonstrated to be specifically expressed in human and murine testis. In the latter, Brdt mRNA has been observed from pachytene spermatocytes to spermatids. In man, a splicing variant of the BRDT gene (BRDT-NY) was found in embryonic and adult human testis and spermatozoa from fertile men. By contrast, transcripts of this splicing variant could not be detected in testis of some azoospermic men including arrest of spermatogenesis at the level of round spermatids. As spermatozoa are known to contain a variety of transcripts and mRNAs could be delivered from sperm to oocyte, it might be possible that BRDT mRNA influences chromatin compaction during spermiogenesis and/or expression of BRDT during early embryogenesis.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Steilmann C, Cavalcanti M C O, Bartkuhn M, et al. The interaction of modified histones with the bromodomain testis-specific (BRDT) gene and its mRNA level in sperm of fertile donors and subfertile men[J]. Reproduction, 2010, 140(3): 435-443.
  • Size / Price
    Catalog: HG11602-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"