Text Size:AAA

Human B Raf Gene ORF cDNA clone expression plasmid, C-HA tag

  • Human B Raf Gene Expression validated Image 16868
  • Human BRAF ORF mammalian expression plasmid, C-HA tag
DatasheetReviewsRelated ProductsProtocols
Human BRAF cDNA Clone Product Information
NCBI RefSeq:NM_004333.4
RefSeq ORF Size:2301bp
cDNA Description:Full length Clone DNA of Homo sapiens v-raf murine sarcoma viral oncogene homolog B1 with C terminal HA tag.
Gene Synonym:BRAF1, RAFB1, B-RAF1, FLJ95109, MGC126806, MGC138284
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-BRAF-HA
Restriction Site:HindIII + XbaI (6kb+2.34kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BRAF qPCR primers for gene expression analysis, HP101484 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BRAF Gene Plasmid Map
Human BRAF ORF mammalian expression plasmid, C-HA tag
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
  • Size / Price
    Catalog: HG11632-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"