After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BPIFB1 / LPLUNC1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human BPIFB1 cDNA Clone Product Information
NCBI RefSeq:BC008429
RefSeq ORF Size:1455bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 20 open reading frame 114 with N terminal Myc tag.
Gene Synonym:LPLUNC1, C20orf114, BPIFB1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. BPIFB1 is expressed in the upper respiratory tract and oral cavity, which may function in host defence. The expression of BPIF proteins is associated with CF lung disease in humans and mice. It is unclear if this elevation of protein production, which results from phenotypic alteration of the cells within the diseased epithelium, plays a role in the pathogenesis of the disease. BPIFB1 is an abundant, secreted product of goblet cells and minor mucosal glands of the respiratory tract and oral cavity and suggest that the protein functions in the complex milieu that protects the mucosal surfaces in these locations.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"