Quick Order

Human BPHL Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human BPHL cDNA Clone Product Information
    NCBI RefSeq:BC106901
    RefSeq ORF Size:825bp
    cDNA Description:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal His tag.
    Gene Synonym:MCNAA, BPH-RP, VACVASE
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BPHL qPCR primers for gene expression analysis, HP102354 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

    References
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Catalog: HG15763-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"