BNIPL cDNA ORF Clone, Human, N-His tag

Cat: HG11460-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BNIPL Reagents
CRO Services
Product recommended

All BNIPL Reagents
BNIPL cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human BCL2/adenovirus E1B 19kD interacting protein like with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BNIPL cDNA ORF Clone, Human, N-His tag Alternative Names
BNIP-S cDNA ORF Clone, Human;BNIPL-1 cDNA ORF Clone, Human;BNIPL-2 cDNA ORF Clone, Human;BNIPL1 cDNA ORF Clone, Human;BNIPL2 cDNA ORF Clone, Human;BNIPS cDNA ORF Clone, Human;PP753 cDNA ORF Clone, Human
BNIPL Background Information

BNIP-2- like (BNIPL), also known as Bcl-2/adenovirus E1B 19 kDa interacting protein 2-like, is a apaptosis-associated protein that shares 72% homology with BNIP-2. BNIPL is highly expressed in human placenta and lung. There are two alternative splices: BNIPL-1 and BNIPL-2. Both BNIPL-1 and BNIPL-2 have a conserved arginine-patch motif in Rho protein family. BNIPL-1 has function in suppressing cell growth through binding to MIF (macrophage migration inhibitory factor) and GFER (growth factor erv1(saccharomyces cerevisiae)-like). BNIPL-2 may suppress the Cdc42GAP’s activity through ineracting with Cdc42GAP. BNIPL-2, containg a key BCH domain, which may induce the cell pseudopod growth, takes part in modulating cell migrations. Thus it suggested BNIPL-2 implicated in cell migration progresses and tumor translocation.

Full Name
BCL2/adenovirus E1B 19kD interacting protein like
References
  • Shen L, et al. (2003) The apoptosis-associated protein BNIPL interacts with two cell proliferation-related proteins, MIF and GFER. FEBS. 540(1-3): 86-90.
  • Qin WX, et al. (2003) BNIPL-2, a novel homologue of BNIP-2, interacts with Bcl-2 and Cdc42GAP in apoptosis. Biochemical and Biophysical Research Communications. 308(2): 379-85.
  • Yasuda M, et al. (1999) BNIP3 alpha: a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res. 59 (3): 533-7.
  • info info
    添加购物车成功! 添加购物车失败!