Quick Order

Text Size:AAA

Human BNIPL Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human BNIPL cDNA Clone Product Information
NCBI RefSeq:BC027868.1
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2/adenovirus E1B 19kD interacting protein like with N terminal His tag.
Gene Synonym:PP753, BNIP-S, BNIPL-1, BNIPL-2, BNIPL
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BNIP-2- like (BNIPL), also known as Bcl-2/adenovirus E1B 19 kDa interacting protein 2-like, is a apaptosis-associated protein that shares 72% homology with BNIP-2. BNIPL is highly expressed in human placenta and lung. There are two alternative splices: BNIPL-1 and BNIPL-2. Both BNIPL-1 and BNIPL-2 have a conserved arginine-patch motif in Rho protein family. BNIPL-1 has function in suppressing cell growth through binding to MIF (macrophage migration inhibitory factor) and GFER (growth factor erv1(saccharomyces cerevisiae)-like). BNIPL-2 may suppress the Cdc42GAP’s activity through ineracting with Cdc42GAP. BNIPL-2, containg a key BCH domain, which may induce the cell pseudopod growth, takes part in modulating cell migrations. Thus it suggested BNIPL-2 implicated in cell migration progresses and tumor translocation.

References
  • Shen L, et al. (2003) The apoptosis-associated protein BNIPL interacts with two cell proliferation-related proteins, MIF and GFER. FEBS. 540(1-3): 86-90.
  • Qin WX, et al. (2003) BNIPL-2, a novel homologue of BNIP-2, interacts with Bcl-2 and Cdc42GAP in apoptosis. Biochemical and Biophysical Research Communications. 308(2): 379-85.
  • Yasuda M, et al. (1999) BNIP3 alpha: a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res. 59 (3): 533-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"