After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human BMP-7 natural ORF mammalian expression plasmid, HA tag

DatasheetReviewsRelated ProductsProtocols
Human BMP-7 cDNA Clone Product Information
NCBI RefSeq:NM_001719.2
RefSeq ORF Size:1296bp
cDNA Description:Full length Clone DNA of Homo sapiens bone morphogenetic protein 7 with HA tag.
Gene Synonym:BMP7, OP-1
Species:Human
Vector:pCMV2-HA
Plasmid:pCMV2-BMP7-ha
Restriction Site:KpnI + XbaI (5.4kb + 1.35kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BMP-7 Gene Plasmid Map
Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
 
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

BMP-7 (Bone morphogenetic protein 7), also known as osteogenic protein 1 (OP-1), is a bone morphogenetic protein which belongs to the TGF-β superfamily. OP-1 is expressed in the brain, kidneys and bladder. BMP-7 may be involved in bone homeostasis. Osteogenic protein 1 plays a key role in the transformation of mesenchymal cells into bone and cartilage. The phosphorylation of SMAD1 and SMAD5 can be induced by BMP-7, which in turn induce transcription of numerous osteogenic genes. BMP-7 treatment can also induce all of the genetic markers of osteoblast differentiation in many cell types. The expression of BMP-7 causes ventral phenotypes while its complete inhibition creates a dorsal phenotype. Human recombinant BMP-7 protein can be used to aid in the fusion of vertebral bodies to prevent neurologic trauma. It also functions in the treatment of tibial non-union, frequently in cases where a bone graft has failed. It is found that BMP7 has the potential for treatment of chronic kidney disease.

References
  • Shi J. et al., 2010, Fertil Steril. 93(4): 1273-9.
  • González EA. et al., 2002, Kidney Int. 61(4): 1322-31.
  • Gould SE. et al., 2002, Kidney Int. 61(1): 51-60.
  • Hahn GV. et al., 1992, Genomics. 14(3): 759-62.
  • Size / Price
    Catalog: HG10083-M-Y
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeks
     Shipping instructions
    Images
    • Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"