After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human BMP-7 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human BMP7 cDNA Clone Product Information
NCBI RefSeq:NM_001719.2
RefSeq ORF Size:1296bp
cDNA Description:Full length Clone DNA of Homo sapiens bone morphogenetic protein 7 with C terminal Myc tag.
Gene Synonym:BMP7, OP-1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

BMP-7 (Bone morphogenetic protein 7), also known as osteogenic protein 1 (OP-1), is a bone morphogenetic protein which belongs to the TGF-β superfamily. OP-1 is expressed in the brain, kidneys and bladder. BMP-7 may be involved in bone homeostasis. Osteogenic protein 1 plays a key role in the transformation of mesenchymal cells into bone and cartilage. The phosphorylation of SMAD1 and SMAD5 can be induced by BMP-7, which in turn induce transcription of numerous osteogenic genes. BMP-7 treatment can also induce all of the genetic markers of osteoblast differentiation in many cell types. The expression of BMP-7 causes ventral phenotypes while its complete inhibition creates a dorsal phenotype. Human recombinant BMP-7 protein can be used to aid in the fusion of vertebral bodies to prevent neurologic trauma. It also functions in the treatment of tibial non-union, frequently in cases where a bone graft has failed. It is found that BMP7 has the potential for treatment of chronic kidney disease.

References
  • Shi J. et al., 2010, Fertil Steril. 93(4): 1273-9.
  • González EA. et al., 2002, Kidney Int. 61(4): 1322-31.
  • Gould SE. et al., 2002, Kidney Int. 61(1): 51-60.
  • Hahn GV. et al., 1992, Genomics. 14(3): 759-62.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"