BMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10426-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMP-2 Reagents
CRO Services
Product recommended

All BMP-2 Reagents
BMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human bone morphogenetic protein 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.24kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BMP-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human BMP-2 Gene Expression validated Image 1538
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
BMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BDA2 cDNA ORF Clone, Human;BDA2A cDNA ORF Clone, Human;BMP-2 cDNA ORF Clone, Human;BMP2A cDNA ORF Clone, Human
BMP-2 Background Information

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

Full Name
bone morphogenetic protein 2
References
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • BMP-2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Canine DG70088-G
    BMP-2 cDNA ORF Clone, Canine, untagged DG70088-UT
    BMP-2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70088-ACG
    BMP-2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70088-ACGLN
    BMP-2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70088-ACR
    BMP-2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70088-CF
    BMP-2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70088-NF
    BMP-2 cDNA ORF Clone, Canine, C-His tag DG70088-CH
    BMP-2 cDNA ORF Clone, Canine, N-His tag DG70088-NH
    BMP-2 cDNA ORF Clone, Canine, C-HA tag DG70088-CY
    BMP-2 cDNA ORF Clone, Canine, N-HA tag DG70088-NY
    BMP-2 cDNA ORF Clone, Canine, C-Myc tag DG70088-CM
    BMP-2 cDNA ORF Clone, Canine, N-Myc tag DG70088-NM

    BMP-2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Rhesus CG90041-G
    BMP-2 cDNA ORF Clone, Rhesus, untagged CG90041-UT
    BMP-2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90041-ACGLN
    BMP-2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90041-ACG
    BMP-2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90041-ACR
    BMP-2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90041-CF
    BMP-2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90041-NF
    BMP-2 cDNA ORF Clone, Rhesus, C-His tag CG90041-CH
    BMP-2 cDNA ORF Clone, Rhesus, N-His tag CG90041-NH
    BMP-2 cDNA ORF Clone, Rhesus, C-HA tag CG90041-CY
    BMP-2 cDNA ORF Clone, Rhesus, N-HA tag CG90041-NY
    BMP-2 cDNA ORF Clone, Rhesus, C-Myc tag CG90041-CM
    BMP-2 cDNA ORF Clone, Rhesus, N-Myc tag CG90041-NM

    BMP-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Mouse MG51115-G
    BMP-2 cDNA ORF Clone, Mouse, untagged MG51115-UT
    BMP-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51115-ACGLN
    BMP-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51115-ACG
    BMP-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51115-ACR
    BMP-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51115-CF
    BMP-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51115-G-F
    BMP-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51115-NF
    BMP-2 cDNA ORF Clone, Mouse, C-His tag MG51115-CH
    BMP-2 cDNA ORF Clone, Mouse, N-His tag MG51115-NH
    BMP-2 cDNA ORF Clone, Mouse, C-HA tag MG51115-CY
    BMP-2 cDNA ORF Clone, Mouse, N-HA tag MG51115-NY
    BMP-2 cDNA ORF Clone, Mouse, C-Myc tag MG51115-CM
    BMP-2 cDNA ORF Clone, Mouse, N-Myc tag MG51115-NM
    BMP-2 qPCR Primer Pairs, Mouse MP201066

    BMP-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Human HG10426-G
    BMP-2 cDNA ORF Clone, Human, untagged HG10426-UT
    BMP-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10426-ACG
    BMP-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10426-ACGLN
    BMP-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10426-ACR
    BMP-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10426-NF
    BMP-2 cDNA ORF Clone, Human, C-His tag HG10426-CH
    BMP-2 cDNA ORF Clone, Human, N-His tag HG10426-NH
    BMP-2 cDNA ORF Clone, Human, C-HA tag HG10426-CY
    BMP-2 cDNA ORF Clone, Human, N-HA tag HG10426-NY
    BMP-2 cDNA ORF Clone, Human, C-Myc tag HG10426-CM
    BMP-2 cDNA ORF Clone, Human, N-Myc tag HG10426-NM
    BMP-2 qPCR Primer Pairs, Human HP100456

    BMP-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BMP-2 qPCR Primer Pairs, Rat RP300058
    info info
    添加购物车成功! 添加购物车失败!