BLVRB cDNA ORF Clone, Human, N-His tag

Cat: HG13151-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BLVRB Reagents
CRO Services
Product recommended

All BLVRB Reagents
BLVRB cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Human biliverdin reductase B (flavin reductase (NADPH)) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BLVRB cDNA ORF Clone, Human, N-His tag Alternative Names
BVRB cDNA ORF Clone, Human;FLR cDNA ORF Clone, Human;HEL-S-10 cDNA ORF Clone, Human;SDR43U1 cDNA ORF Clone, Human
BLVRB Background Information

Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. BVR consists of an N-terminal dinucleotide-binding domain (Rossmann-fold) and a C-terminal domain that contains a six-stranded β-sheet that is flanked on one face by several α-helices. The C-terminal and N-terminal domains interact extensively, forming the active site cleft at their interface. Biliverdin reductase (BVR) catalyzes the last step in heme degradation by reducing the γ-methene bridge of the open tetrapyrrole, biliverdin IXα, to bilirubin with the concomitant oxidation of a β-nicotinamide adenine dinucleotide (NADH) or β-nicotinamide adenine dinucleotide phosphate (NADPH) cofactor. It is now recognized that human BVR (hBVR) is a dual-specificity kinase (Ser / Thr and Tyr) upstream activator of the insulin/insulin growth factor-1 (IGF-1) and mitogen-activated protein kinase (MAPK) signaling pathways. Human BVR (hBVR) is essential for MAPK-extracellular signal-regulated kinase (ERK)1/2 (MEK)-eukaryotic-like protein kinase (Elk) signaling and has been identified as the cytoplasm-nuclear heme transporter of ERK1/2 and hematin, the key components of stress-responsive gene expression.

Full Name
biliverdin reductase B
References
  • Kapitulnik J, et al. (2009) Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends in Pharmacological Sciences. 30(3): 129-37.
  • Ahmad Z, et al. (2002) Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress. The Journal of Biological Chemistry. 277: 9226-32.
  • Whitby FG, et al. (2002) Crystal Structure of a Biliverdin IX Reductase Enzyme-Cofactor Complex. Journal of Molecular Biology. 319(5): 1199-210.
  • info info
    添加购物车成功! 添加购物车失败!