Quick Order

Human BLVRB Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human BLVRB cDNA Clone Product Information
    NCBI RefSeq:NM_000713.2
    RefSeq ORF Size:621bp
    cDNA Description:Full length Clone DNA of Homo sapiens biliverdin reductase B (flavin reductase (NADPH)) with N terminal Myc tag.
    Gene Synonym:FLR, BVRB, SDR43U1, MGC117413, BLVRB
    Species:Human
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BLVRB qPCR primers for gene expression analysis, HP101707 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. BVR consists of an N-terminal dinucleotide-binding domain (Rossmann-fold) and a C-terminal domain that contains a six-stranded β-sheet that is flanked on one face by several α-helices. The C-terminal and N-terminal domains interact extensively, forming the active site cleft at their interface. Biliverdin reductase (BVR) catalyzes the last step in heme degradation by reducing the γ-methene bridge of the open tetrapyrrole, biliverdin IXα, to bilirubin with the concomitant oxidation of a β-nicotinamide adenine dinucleotide (NADH) or β-nicotinamide adenine dinucleotide phosphate (NADPH) cofactor. It is now recognized that human BVR (hBVR) is a dual-specificity kinase (Ser / Thr and Tyr) upstream activator of the insulin/insulin growth factor-1 (IGF-1) and mitogen-activated protein kinase (MAPK) signaling pathways. Human BVR (hBVR) is essential for MAPK-extracellular signal-regulated kinase (ERK)1/2 (MEK)-eukaryotic-like protein kinase (Elk) signaling and has been identified as the cytoplasm-nuclear heme transporter of ERK1/2 and hematin, the key components of stress-responsive gene expression.

    References
  • Kapitulnik J, et al. (2009) Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends in Pharmacological Sciences. 30(3): 129-37.
  • Ahmad Z, et al. (2002) Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress. The Journal of Biological Chemistry. 277: 9226-32.
  • Whitby FG, et al. (2002) Crystal Structure of a Biliverdin IX Reductase Enzyme-Cofactor Complex. Journal of Molecular Biology. 319(5): 1199-210.
  • Size / Price
    Catalog: HG13151-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"