Pallidin cDNA ORF Clone, Human, C-HA tag

Cat: HG14661-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Pallidin Reagents
CRO Services
Product recommended

All Pallidin Reagents
Pallidin cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Human biogenesis of lysosomal organelles complex-1, subunit 6, pallidin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Pallidin cDNA ORF Clone, Human, C-HA tag Alternative Names
BLOS6 cDNA ORF Clone, Human;HPS9 cDNA ORF Clone, Human;PA cDNA ORF Clone, Human;PALLID cDNA ORF Clone, Human;PLDN cDNA ORF Clone, Human
Pallidin Background Information
Full Name
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin

Pallidin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Pallidin cDNA ORF Clone in Cloning Vector, Mouse MG57706-U
Pallidin cDNA ORF Clone, Mouse, untagged MG57706-UT
Pallidin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57706-ACG
Pallidin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57706-ACGLN
Pallidin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57706-ANG
Pallidin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57706-ACR
Pallidin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57706-ANR
Pallidin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57706-CF
Pallidin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57706-NF
Pallidin cDNA ORF Clone, Mouse, C-His tag MG57706-CH
Pallidin cDNA ORF Clone, Mouse, N-His tag MG57706-NH
Pallidin cDNA ORF Clone, Mouse, C-HA tag MG57706-CY
Pallidin cDNA ORF Clone, Mouse, N-HA tag MG57706-NY
Pallidin cDNA ORF Clone, Mouse, C-Myc tag MG57706-CM
Pallidin cDNA ORF Clone, Mouse, N-Myc tag MG57706-NM

Pallidin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Pallidin cDNA ORF Clone in Cloning Vector, Human HG14661-G
Pallidin cDNA ORF Clone, Human, untagged HG14661-UT
Pallidin cDNA ORF Clone, Human, C-GFPSpark® tag HG14661-ACG
Pallidin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14661-ACGLN
Pallidin cDNA ORF Clone, Human, N-GFPSpark® tag HG14661-ANG
Pallidin cDNA ORF Clone, Human, C-OFPSpark® tag HG14661-ACR
Pallidin cDNA ORF Clone, Human, N-OFPSpark® tag HG14661-ANR
Pallidin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14661-CF
Pallidin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14661-NF
Pallidin cDNA ORF Clone, Human, C-His tag HG14661-CH
Pallidin cDNA ORF Clone, Human, N-His tag HG14661-NH
Pallidin cDNA ORF Clone, Human, N-HA tag HG14661-NY
Pallidin cDNA ORF Clone, Human, C-Myc tag HG14661-CM
Pallidin cDNA ORF Clone, Human, N-Myc tag HG14661-NM
Pallidin qPCR Primer Pairs, Human HP103295
info info
添加购物车成功! 添加购物车失败!