BLMH cDNA ORF Clone, Human, N-HA tag

Cat: HG11333-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BLMH Reagents
CRO Services
Product recommended

All BLMH Reagents
BLMH cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1368 bp
Description
Full length Clone DNA of Human bleomycin hydrolase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BLMH cDNA ORF Clone, Human, N-HA tag Alternative Names
BH cDNA ORF Clone, Human;BMH cDNA ORF Clone, Human
BLMH Background Information

The papain superfamily member bleomycin hydrolase (BLMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution. The only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The papain superfamily member bleomycin hydrolase (BLMH) is a neutral cysteine protease with structural similarity to a 20S proteasome. Bleomycin (BLM), a clinically used glycopeptide anticancer agent. BLMH is an essential protectant against BLM-induced death and has an important role in neonatal survival and in maintaining epidermal integrity. Sequencing revealed several putative sites phosphorylated by different types of protein kinases, but no signal sequence, transmembrane domain, N-linked glycosylation site or DNA-binding motif.

Full Name
bleomycin hydrolase
Research Areas
References
  • Takeda A, et al. (1996) Cloning and Analysis of cDNA Encoding Rat Bleomycin Hydrolase, a DNA-Binding Cysteine Protease. J Biochem. 120 (2): 353-9.
  • Lefterov IM, et al. (2000) Human bleomycin hydrolase regulates the secretion of amyloid precursor protein. The FASEB Journal. 14(12): 1837-47.
  • Brmme D, et al. (1996) Human Bleomycin Hydrolase: Molecular Cloning, Sequencing, Functional Expression, and Enzymatic Characterization. Biochemistry. 35 (21): 6706-14.
  • BLMH cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BLMH cDNA ORF Clone in Cloning Vector, Rat RG80859-U
    BLMH cDNA ORF Clone, Rat, untagged RG80859-UT
    BLMH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80859-ACGLN
    BLMH cDNA ORF Clone, Rat, C-GFPSpark® tag RG80859-ACG
    BLMH cDNA ORF Clone, Rat, N-GFPSpark® tag RG80859-ANG
    BLMH cDNA ORF Clone, Rat, C-OFPSpark® tag RG80859-ACR
    BLMH cDNA ORF Clone, Rat, N-OFPSpark® tag RG80859-ANR
    BLMH cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80859-CF
    BLMH cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80859-NF
    BLMH cDNA ORF Clone, Rat, C-His tag RG80859-CH
    BLMH cDNA ORF Clone, Rat, N-His tag RG80859-NH
    BLMH cDNA ORF Clone, Rat, C-HA tag RG80859-CY
    BLMH cDNA ORF Clone, Rat, N-HA tag RG80859-NY
    BLMH cDNA ORF Clone, Rat, C-Myc tag RG80859-CM
    BLMH cDNA ORF Clone, Rat, N-Myc tag RG80859-NM
    BLMH qPCR Primer Pairs, Rat RP300823

    BLMH cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BLMH cDNA ORF Clone in Cloning Vector, Mouse MG50668-M
    BLMH cDNA ORF Clone, Mouse, untagged MG50668-UT
    BLMH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50668-ACGLN
    BLMH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50668-ACG
    BLMH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50668-ANG
    BLMH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50668-ACR
    BLMH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50668-ANR
    BLMH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50668-CF
    BLMH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50668-NF
    BLMH cDNA ORF Clone, Mouse, C-His tag MG50668-CH
    BLMH cDNA ORF Clone, Mouse, N-His tag MG50668-NH
    BLMH cDNA ORF Clone, Mouse, C-HA tag MG50668-CY
    BLMH cDNA ORF Clone, Mouse, N-HA tag MG50668-NY
    BLMH cDNA ORF Clone, Mouse, C-Myc tag MG50668-CM
    BLMH cDNA ORF Clone, Mouse, N-Myc tag MG50668-NM
    BLMH qPCR Primer Pairs, Mouse MP200647

    BLMH cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BLMH cDNA ORF Clone in Cloning Vector, Human HG11333-M
    BLMH cDNA ORF Clone, Human, untagged HG11333-UT
    BLMH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11333-ACGLN
    BLMH cDNA ORF Clone, Human, C-GFPSpark® tag HG11333-ACG
    BLMH cDNA ORF Clone, Human, N-GFPSpark® tag HG11333-ANG
    BLMH cDNA ORF Clone, Human, C-OFPSpark® tag HG11333-ACR
    BLMH cDNA ORF Clone, Human, N-OFPSpark® tag HG11333-ANR
    BLMH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11333-CF
    BLMH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11333-NF
    BLMH cDNA ORF Clone, Human, C-His tag HG11333-CH
    BLMH cDNA ORF Clone, Human, N-His tag HG11333-NH
    BLMH cDNA ORF Clone, Human, C-HA tag HG11333-CY
    BLMH cDNA ORF Clone, Human, C-Myc tag HG11333-CM
    BLMH cDNA ORF Clone, Human, N-Myc tag HG11333-NM
    BLMH qPCR Primer Pairs, Human HP101218
    info info
    添加购物车成功! 添加购物车失败!