Quick Order

Text Size:AAA

Human BLMH/Bleomycin Hydrolase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BLMH cDNA Clone Product Information
NCBI RefSeq:NM_000386.2
RefSeq ORF Size:1368bp
cDNA Description:Full length Clone DNA of Homo sapiens bleomycin hydrolase.
Gene Synonym:BH, BMH, BLMH
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-BLMH
Restriction Site:KpnI + XbaI (6.1kb + 1.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 603 C/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BLMH Gene Plasmid Map
Human BLMH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

The papain superfamily member bleomycin hydrolase (BLMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution. The only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The papain superfamily member bleomycin hydrolase (BLMH) is a neutral cysteine protease with structural similarity to a 20S proteasome. Bleomycin (BLM), a clinically used glycopeptide anticancer agent. BLMH is an essential protectant against BLM-induced death and has an important role in neonatal survival and in maintaining epidermal integrity. Sequencing revealed several putative sites phosphorylated by different types of protein kinases, but no signal sequence, transmembrane domain, N-linked glycosylation site or DNA-binding motif.

References
  • Takeda A, et al. (1996) Cloning and Analysis of cDNA Encoding Rat Bleomycin Hydrolase, a DNA-Binding Cysteine Protease. J Biochem. 120 (2): 353-9.
  • Lefterov IM, et al. (2000) Human bleomycin hydrolase regulates the secretion of amyloid precursor protein. The FASEB Journal. 14(12): 1837-47.
  • Brmme D, et al. (1996) Human Bleomycin Hydrolase: Molecular Cloning, Sequencing, Functional Expression, and Enzymatic Characterization. Biochemistry. 35 (21): 6706-14.
  • Size / Price
    Catalog: HG11333-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human BLMH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"