BIN3 cDNA ORF Clone, Human, untagged

Cat: HG14300-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BIN3 Reagents
CRO Services
Product recommended

All BIN3 Reagents
BIN3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
762 bp
Description
Full length Clone DNA of Human bridging integrator 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BIN3 Background Information
Full Name
bridging integrator 3

BIN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BIN3 cDNA ORF Clone in Cloning Vector, Mouse MG52706-U
BIN3 cDNA ORF Clone, Mouse, untagged MG52706-UT
BIN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52706-ACG
BIN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52706-ACGLN
BIN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52706-ANG
BIN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52706-ACR
BIN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52706-ANR
BIN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52706-CF
BIN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52706-NF
BIN3 cDNA ORF Clone, Mouse, C-His tag MG52706-CH
BIN3 cDNA ORF Clone, Mouse, N-His tag MG52706-NH
BIN3 cDNA ORF Clone, Mouse, C-HA tag MG52706-CY
BIN3 cDNA ORF Clone, Mouse, N-HA tag MG52706-NY
BIN3 cDNA ORF Clone, Mouse, C-Myc tag MG52706-CM
BIN3 cDNA ORF Clone, Mouse, N-Myc tag MG52706-NM
BIN3 qPCR Primer Pairs, Mouse MP202577

BIN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BIN3 cDNA ORF Clone in Cloning Vector, Human HG14300-G
BIN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14300-ACG
BIN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14300-ACGLN
BIN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14300-ANG
BIN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14300-ACR
BIN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14300-ANR
BIN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14300-CF
BIN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14300-NF
BIN3 cDNA ORF Clone, Human, C-His tag HG14300-CH
BIN3 cDNA ORF Clone, Human, N-His tag HG14300-NH
BIN3 cDNA ORF Clone, Human, C-HA tag HG14300-CY
BIN3 cDNA ORF Clone, Human, N-HA tag HG14300-NY
BIN3 cDNA ORF Clone, Human, C-Myc tag HG14300-CM
BIN3 cDNA ORF Clone, Human, N-Myc tag HG14300-NM
BIN3 qPCR Primer Pairs, Human HP102950
info info
添加购物车成功! 添加购物车失败!