Text Size:AAA

Human BIK Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human BIK cDNA Clone Product Information
    NCBI RefSeq:NM_001197.3
    RefSeq ORF Size:483bp
    cDNA Description:Full length Clone DNA of Homo sapiens BCL2-interacting killer (apoptosis-inducing) with N terminal His tag.
    Gene Synonym:BP4, NBK, BIP1, BIK
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BIK qPCR primers for gene expression analysis, HP101183 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    The BIN1 protein, which is encoded by the BIN1 gene, belongs to Myc-interacting protein family which is one of the nucleocytoplasmic adaptor proteins. The BIN1 protein can interact with the functionally critically Myc-box region at the N-terminal of the Myc oncoprotein, with a feature of tumor suppressor. Myc family proteins promote proliferation, growth, and apoptosis and, when deregulated, are profoundly involved in the genesis of an extraordinarily wide range of cancers. Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally significant because ectopic expression of BIN1 inhibited the growth of tumour cells lacking endogenous message. We conclude that BIN1 is an MYC-interacting protein with features of a tumour suppressor.

    References
  • Boyd J.M., et al.,(1995), Bik, a novel death-inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11:1921-1928.
  • Han J., et al., (1996), Induction of apoptosis by human Nbk/Bik, a BH3-containing protein that interacts with E1B 19K.Mol. Cell. Biol. 16:5857-5864.
  • Hegde R., et al.,(1998), Blk, a BH3-containing mouse protein that interacts with Bcl-2 and Bcl-xL, is a potent death agonist.J. Biol. Chem. 273:7783-7786.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"