Quick Order

Text Size:AAA

Human BCL6 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BCL6 cDNA Clone Product Information
NCBI RefSeq:NM_138931
RefSeq ORF Size:2121bp
cDNA Description:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6.
Gene Synonym:ZBTB27, LAZ3, BCL5, BCL6A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-BCL6
Restriction Site:KpnI + XbaI (6.1kb + 2.12kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BCL6 Gene Plasmid Map
Human BCL6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

References
  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Catalog: HG12083-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human BCL6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"