Quick Order

Human BCL2L11 / Bim Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human BCL2L11 cDNA Clone Product Information
NCBI RefSeq:BC033694
RefSeq ORF Size:597bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2-like 11 (apoptosis facilitator) with N terminal His tag.
Gene Synonym:BAM, BIM, BIM-alpha6, BIM-beta6, BIM-beta7, BOD, BimEL, BimL, BCL2L11
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BCL2L11, also known as Bim, belongs to the BCL-2 protein family. Members of this family form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. BCL2L11 contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family, including BCL2, BCL2L1/BCL-X(L), and MCL1, and to act as an apoptotic activator. BCL2L11 gene functions as an essential initiator of apoptosis in thymocyte-negative selection.

References
  • Day Catherine L. et al., 2004, Biochem J. 377 (3): 597-605.
  • Murray S. et al., 2001, Cytogenet Cell Genet. 92 (3-4): 353.
  • Hsu SY. et al., 1998,Mol Endocrinol. 12 (9): 1432-40.
  • Size / Price
    Catalog: HG13816-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"