After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human BCL2A1 cDNA Clone Product Information
NCBI RefSeq:NM_004049.3
RefSeq ORF Size:528bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2-related protein A1,transcript variant 1 with C terminal His tag.
Gene Synonym:GRS, BFL1, ACC-1, ACC-2, HBPA1, BCL2L5
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10562-ACG$225
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10562-ACR$225
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10562-ANG$225
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10562-ANR$225
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10562-CF$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10562-CH$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10562-CM$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10562-CY$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10562-M$75
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10562-M-F$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10562-NF$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10562-NH$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10562-NM$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10562-NY$195
Human Bcl2A1/Bfl-1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10562-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10562-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"