BCKDK cDNA ORF Clone, Human, N-Myc tag

Cat: HG11549-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BCKDK Reagents
CRO Services
Product recommended

All BCKDK Reagents
BCKDK cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Human branched chain ketoacid dehydrogenase kinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCKDK cDNA ORF Clone, Human, N-Myc tag Alternative Names
BCKDKD cDNA ORF Clone, Human;BDK cDNA ORF Clone, Human
BCKDK Background Information
Full Name
branched chain ketoacid dehydrogenase kinase

BCKDK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BCKDK cDNA ORF Clone in Cloning Vector, Mouse MG53234-G
BCKDK cDNA ORF Clone, Mouse, untagged MG53234-UT
BCKDK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53234-ACGLN
BCKDK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53234-ACG
BCKDK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53234-ANG
BCKDK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53234-ACR
BCKDK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53234-ANR
BCKDK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53234-CF
BCKDK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53234-NF
BCKDK cDNA ORF Clone, Mouse, C-His tag MG53234-CH
BCKDK cDNA ORF Clone, Mouse, N-His tag MG53234-NH
BCKDK cDNA ORF Clone, Mouse, C-HA tag MG53234-CY
BCKDK cDNA ORF Clone, Mouse, N-HA tag MG53234-NY
BCKDK cDNA ORF Clone, Mouse, C-Myc tag MG53234-CM
BCKDK cDNA ORF Clone, Mouse, N-Myc tag MG53234-NM

BCKDK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BCKDK cDNA ORF Clone in Cloning Vector, Human HG11549-M
BCKDK cDNA ORF Clone, Human, untagged HG11549-UT
BCKDK cDNA ORF Clone, Human, C-GFPSpark® tag HG11549-ACG
BCKDK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11549-ACGLN
BCKDK cDNA ORF Clone, Human, N-GFPSpark® tag HG11549-ANG
BCKDK cDNA ORF Clone, Human, C-OFPSpark® tag HG11549-ACR
BCKDK cDNA ORF Clone, Human, N-OFPSpark® tag HG11549-ANR
BCKDK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11549-CF
BCKDK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11549-NF
BCKDK cDNA ORF Clone, Human, C-His tag HG11549-CH
BCKDK cDNA ORF Clone, Human, N-His tag HG11549-NH
BCKDK cDNA ORF Clone, Human, C-HA tag HG11549-CY
BCKDK cDNA ORF Clone, Human, N-HA tag HG11549-NY
BCKDK cDNA ORF Clone, Human, C-Myc tag HG11549-CM
BCKDK qPCR Primer Pairs, Human HP101662
info info
添加购物车成功! 添加购物车失败!