BCCIP cDNA ORF Clone, Human, untagged

Cat: HG14442-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BCCIP Reagents
CRO Services
Product recommended

All BCCIP Reagents
BCCIP cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Human BRCA2 and CDKN1A interacting protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCCIP cDNA ORF Clone, Human, untagged Alternative Names
TOK-1 cDNA ORF Clone, Human;TOK1 cDNA ORF Clone, Human
BCCIP Background Information
Full Name
BRCA2 and CDKN1A interacting protein

BCCIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BCCIP cDNA ORF Clone in Cloning Vector, Mouse MG52818-U
BCCIP cDNA ORF Clone, Mouse, untagged MG52818-UT
BCCIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52818-ACG
BCCIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52818-ACGLN
BCCIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52818-ANG
BCCIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52818-ACR
BCCIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52818-ANR
BCCIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52818-CF
BCCIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52818-NF
BCCIP cDNA ORF Clone, Mouse, C-His tag MG52818-CH
BCCIP cDNA ORF Clone, Mouse, N-His tag MG52818-NH
BCCIP cDNA ORF Clone, Mouse, C-HA tag MG52818-CY
BCCIP cDNA ORF Clone, Mouse, N-HA tag MG52818-NY
BCCIP cDNA ORF Clone, Mouse, C-Myc tag MG52818-CM
BCCIP cDNA ORF Clone, Mouse, N-Myc tag MG52818-NM

BCCIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BCCIP cDNA ORF Clone in Cloning Vector, Human HG14442-G
BCCIP cDNA ORF Clone, Human, C-GFPSpark® tag HG14442-ACG
BCCIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14442-ACGLN
BCCIP cDNA ORF Clone, Human, N-GFPSpark® tag HG14442-ANG
BCCIP cDNA ORF Clone, Human, C-OFPSpark® tag HG14442-ACR
BCCIP cDNA ORF Clone, Human, N-OFPSpark® tag HG14442-ANR
BCCIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14442-CF
BCCIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14442-NF
BCCIP cDNA ORF Clone, Human, C-His tag HG14442-CH
BCCIP cDNA ORF Clone, Human, N-His tag HG14442-NH
BCCIP cDNA ORF Clone, Human, C-HA tag HG14442-CY
BCCIP cDNA ORF Clone, Human, N-HA tag HG14442-NY
BCCIP cDNA ORF Clone, Human, C-Myc tag HG14442-CM
BCCIP cDNA ORF Clone, Human, N-Myc tag HG14442-NM
BCCIP qPCR Primer Pairs, Human HP103090
info info
添加购物车成功! 添加购物车失败!