BCAT2/BCATM cDNA ORF Clone, Human, untagged

Cat: HG10228-M-N
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BCAT2/BCATM Reagents
CRO Services

All BCAT2/BCATM Reagents
BCAT2/BCATM cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human branched chain aminotransferase 2, mitochondrial, nuclear gene encoding mitochondrial protein DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BCAT2/BCATM cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCAT2/BCATM cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
BCAT2/BCATM cDNA ORF Clone, Human, untagged Alternative Names
BCAM cDNA ORF Clone, Human;BCATM cDNA ORF Clone, Human;BCT2 cDNA ORF Clone, Human;PP18 cDNA ORF Clone, Human
BCAT2/BCATM Background Information
Full Name
branched chain amino-acid transaminase 2, mitochondrial

BCAT2/BCATM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BCAT2/BCATM cDNA ORF Clone in Cloning Vector, Mouse MG53345-U
BCAT2/BCATM cDNA ORF Clone, Mouse, untagged MG53345-UT
BCAT2/BCATM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53345-ACG
BCAT2/BCATM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53345-ACGLN
BCAT2/BCATM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53345-ANG
BCAT2/BCATM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53345-ACR
BCAT2/BCATM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53345-ANR
BCAT2/BCATM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53345-CF
BCAT2/BCATM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53345-NF
BCAT2/BCATM cDNA ORF Clone, Mouse, C-His tag MG53345-CH
BCAT2/BCATM cDNA ORF Clone, Mouse, N-His tag MG53345-NH
BCAT2/BCATM cDNA ORF Clone, Mouse, C-HA tag MG53345-CY
BCAT2/BCATM cDNA ORF Clone, Mouse, N-HA tag MG53345-NY
BCAT2/BCATM cDNA ORF Clone, Mouse, C-Myc tag MG53345-CM
BCAT2/BCATM cDNA ORF Clone, Mouse, N-Myc tag MG53345-NM

BCAT2/BCATM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BCAT2/BCATM cDNA ORF Clone in Cloning Vector, Human HG10228-M
BCAT2/BCATM cDNA ORF Clone, Human, untagged HG10228-UT
BCAT2/BCATM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10228-ACGLN
BCAT2/BCATM cDNA ORF Clone, Human, C-GFPSpark® tag HG10228-ACG
BCAT2/BCATM cDNA ORF Clone, Human, N-GFPSpark® tag HG10228-ANG
BCAT2/BCATM cDNA ORF Clone, Human, C-OFPSpark® tag HG10228-ACR
BCAT2/BCATM cDNA ORF Clone, Human, N-OFPSpark® tag HG10228-ANR
BCAT2/BCATM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10228-CF
BCAT2/BCATM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10228-NF
BCAT2/BCATM cDNA ORF Clone, Human, C-His tag HG10228-CH
BCAT2/BCATM cDNA ORF Clone, Human, N-His tag HG10228-NH
BCAT2/BCATM cDNA ORF Clone, Human, C-HA tag HG10228-CY
BCAT2/BCATM cDNA ORF Clone, Human, N-HA tag HG10228-NY
BCAT2/BCATM cDNA ORF Clone, Human, C-Myc tag HG10228-CM
BCAT2/BCATM cDNA ORF Clone, Human, N-Myc tag HG10228-NM
BCAT2/BCATM qPCR Primer Pairs, Human HP100283
info info
添加购物车成功! 添加购物车失败!