BCAS2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15034-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BCAS2 Reagents
CRO Services
Product recommended

All BCAS2 Reagents
BCAS2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Human breast carcinoma amplified sequence 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCAS2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
DAM1 cDNA ORF Clone, Human;Snt309 cDNA ORF Clone, Human;SPF27 cDNA ORF Clone, Human
BCAS2 Background Information
Full Name
breast carcinoma amplified sequence 2

BCAS2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BCAS2 cDNA ORF Clone in Cloning Vector, Rat RG8A1687-U
BCAS2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1687-ACGLN

BCAS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BCAS2 cDNA ORF Clone in Cloning Vector, Mouse MG53698-U
BCAS2 cDNA ORF Clone, Mouse, untagged MG53698-UT
BCAS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53698-ACG
BCAS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53698-ACGLN
BCAS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53698-ANG
BCAS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53698-ACR
BCAS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53698-ANR
BCAS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53698-CF
BCAS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53698-NF
BCAS2 cDNA ORF Clone, Mouse, C-His tag MG53698-CH
BCAS2 cDNA ORF Clone, Mouse, N-His tag MG53698-NH
BCAS2 cDNA ORF Clone, Mouse, C-HA tag MG53698-CY
BCAS2 cDNA ORF Clone, Mouse, N-HA tag MG53698-NY
BCAS2 cDNA ORF Clone, Mouse, C-Myc tag MG53698-CM
BCAS2 cDNA ORF Clone, Mouse, N-Myc tag MG53698-NM

BCAS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BCAS2 cDNA ORF Clone in Cloning Vector, Human HG15034-G
BCAS2 cDNA ORF Clone, Human, untagged HG15034-UT
BCAS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15034-ACGLN
BCAS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15034-ACG
BCAS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15034-ANG
BCAS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15034-ACR
BCAS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15034-ANR
BCAS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15034-CF
BCAS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15034-NF
BCAS2 cDNA ORF Clone, Human, C-His tag HG15034-CH
BCAS2 cDNA ORF Clone, Human, N-His tag HG15034-NH
BCAS2 cDNA ORF Clone, Human, C-HA tag HG15034-CY
BCAS2 cDNA ORF Clone, Human, N-HA tag HG15034-NY
BCAS2 cDNA ORF Clone, Human, C-Myc tag HG15034-CM
BCAS2 qPCR Primer Pairs, Human HP103662
info info
添加购物车成功! 添加购物车失败!