BAMBI cDNA ORF Clone, Human, N-His tag

Cat: HG10890-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BAMBI Reagents
CRO Services
Product recommended

All BAMBI Reagents
BAMBI cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Human BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAMBI cDNA ORF Clone, Human, N-His tag Alternative Names
NMA cDNA ORF Clone, Human
BAMBI Background Information

BMP and activin membrane-bound inhibitor (BAMBI) is a transmembrane glycoprotein that is a pseudoreceptor of type 1 receptors. BAMBI structurally lacks intracellular serine/ threonine kinase domain but with an extracellular domain and a short cytoplasmic region that share sequence similarities with type 1 receptors, whose members have functions in signal transduction in various developing and pathological processes. BAMBI competes with the type 1 receptor, a receptor of the transforming growth factor-beta (TGF-beta), through functioning as negative regulators of TGF-beta by limiting the signaling range of the TGF-beta family during early embryogenesis. The expression of BAMBI can be induced by accumulated beta-catenin and BMP. The expression level of BAMBI was found aberrantly elevated in most colorectal and hepatocellular carcinomas relative to the corresponding non-cancerous tissues. It suggestes that beta-catenin and TGF-beta interfere growth arrest by inducing the expression of BAMBI, and this may contribute to colorectal and hepatocellular tumorigenesis.

Full Name
BMP and activin membrane-bound inhibitor
References
  • Sekiya T, et al. (2003) Identification of BMP and Activin Membrane-bound Inhibitor (BAMBI), an Inhibitor of Transforming Growth Factor- Signaling, as a Target of the -Catenin Pathway in Colorectal Tumor Cells. The Journal of Biological Chemistry. 279:6840-6.
  • Shi YG, et al. (2003) Mechanisms of TGF- Signaling from Cell Membrane to the Nucleus. Cell. 113(6): 685-700.
  • Wanninger J, et al. (2011) Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes. FEBS Lett. 585(9):1338-44.
  • BAMBI cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BAMBI cDNA ORF Clone in Cloning Vector, Mouse MG50895-G
    BAMBI cDNA ORF Clone, Mouse, untagged MG50895-UT
    BAMBI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50895-ACGLN
    BAMBI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50895-ACG
    BAMBI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50895-ACR
    BAMBI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50895-CF
    BAMBI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50895-NF
    BAMBI cDNA ORF Clone, Mouse, C-His tag MG50895-CH
    BAMBI cDNA ORF Clone, Mouse, N-His tag MG50895-NH
    BAMBI cDNA ORF Clone, Mouse, C-HA tag MG50895-CY
    BAMBI cDNA ORF Clone, Mouse, N-HA tag MG50895-NY
    BAMBI cDNA ORF Clone, Mouse, C-Myc tag MG50895-CM
    BAMBI cDNA ORF Clone, Mouse, N-Myc tag MG50895-NM
    BAMBI qPCR Primer Pairs, Mouse MP200866

    BAMBI cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BAMBI cDNA ORF Clone in Cloning Vector, Human HG10890-M
    BAMBI cDNA ORF Clone, Human, untagged HG10890-UT
    BAMBI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10890-ACGLN
    BAMBI cDNA ORF Clone, Human, C-GFPSpark® tag HG10890-ACG
    BAMBI cDNA ORF Clone, Human, C-OFPSpark® tag HG10890-ACR
    BAMBI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10890-CF
    BAMBI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10890-NF
    BAMBI cDNA ORF Clone, Human, C-His tag HG10890-CH
    BAMBI cDNA ORF Clone, Human, C-HA tag HG10890-CY
    BAMBI cDNA ORF Clone, Human, N-HA tag HG10890-NY
    BAMBI cDNA ORF Clone, Human, C-Myc tag HG10890-CM
    BAMBI cDNA ORF Clone, Human, N-Myc tag HG10890-NM
    BAMBI qPCR Primer Pairs, Human HP100775
    info info
    添加购物车成功! 添加购物车失败!