Bak/BAK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10450-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Bak/BAK1 Reagents
CRO Services
Product recommended

All Bak/BAK1 Reagents
Bak/BAK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
636 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human BCL2-antagonist/killer 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.69kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Bak/BAK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bak/BAK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Bak/BAK1 Gene Expression validated Image 1545
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Bak/BAK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BAK cDNA ORF Clone, Human;BAK-LIKE cDNA ORF Clone, Human;BCL2L7 cDNA ORF Clone, Human;CDN1 cDNA ORF Clone, Human
Bak/BAK1 Background Information
Full Name
BCL2-antagonist/killer 1

Bak/BAK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bak/BAK1 cDNA ORF Clone in Cloning Vector, Mouse MG50764-G
Bak/BAK1 cDNA ORF Clone, Mouse, untagged MG50764-UT
Bak/BAK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50764-ACGLN
Bak/BAK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50764-ACG
Bak/BAK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50764-ANG
Bak/BAK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50764-ACR
Bak/BAK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50764-ANR
Bak/BAK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50764-CF
Bak/BAK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50764-NF
Bak/BAK1 cDNA ORF Clone, Mouse, C-His tag MG50764-CH
Bak/BAK1 cDNA ORF Clone, Mouse, N-His tag MG50764-NH
Bak/BAK1 cDNA ORF Clone, Mouse, C-HA tag MG50764-CY
Bak/BAK1 cDNA ORF Clone, Mouse, N-HA tag MG50764-NY
Bak/BAK1 cDNA ORF Clone, Mouse, C-Myc tag MG50764-CM
Bak/BAK1 cDNA ORF Clone, Mouse, N-Myc tag MG50764-NM
Bak/BAK1 qPCR Primer Pairs, Mouse MP200738

Bak/BAK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bak/BAK1 cDNA ORF Clone in Cloning Vector, Human HG10450-M
Bak/BAK1 cDNA ORF Clone, Human, untagged HG10450-UT
Bak/BAK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10450-ACG
Bak/BAK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10450-ACGLN
Bak/BAK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10450-ANG
Bak/BAK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10450-ACR
Bak/BAK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10450-ANR
Bak/BAK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10450-NF
Bak/BAK1 cDNA ORF Clone, Human, C-His tag HG10450-CH
Bak/BAK1 cDNA ORF Clone, Human, N-His tag HG10450-NH
Bak/BAK1 cDNA ORF Clone, Human, C-HA tag HG10450-CY
Bak/BAK1 cDNA ORF Clone, Human, N-HA tag HG10450-NY
Bak/BAK1 cDNA ORF Clone, Human, C-Myc tag HG10450-CM
Bak/BAK1 cDNA ORF Clone, Human, N-Myc tag HG10450-NM
Bak/BAK1 qPCR Primer Pairs, Human HP100479
info info
添加购物车成功! 添加购物车失败!