Bad cDNA ORF Clone, Human, C-HA tag

Cat: HG10020-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Bad Reagents
CRO Services
Product recommended

All Bad Reagents
Bad cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Human BCL2-antagonist of cell death (BAD), transcript variant 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bad cDNA ORF Clone, Human, C-HA tag Alternative Names
BBC2 cDNA ORF Clone, Human;BCL2L8 cDNA ORF Clone, Human
Bad Background Information
Full Name
BCL2-associated agonist of cell death

Bad cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Rat RG81911-U
Bad Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81911-ACGLN

Bad cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Mouse MG51444-G
Bad cDNA ORF Clone, Mouse, untagged MG51444-UT
Bad cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51444-ACG
Bad Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51444-ACGLN
Bad cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51444-ANG
Bad cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51444-ACR
Bad cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51444-ANR
Bad cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51444-CF
Bad cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51444-NF
Bad cDNA ORF Clone, Mouse, C-His tag MG51444-CH
Bad cDNA ORF Clone, Mouse, N-His tag MG51444-NH
Bad cDNA ORF Clone, Mouse, C-HA tag MG51444-CY
Bad cDNA ORF Clone, Mouse, N-HA tag MG51444-NY
Bad cDNA ORF Clone, Mouse, C-Myc tag MG51444-CM
Bad cDNA ORF Clone, Mouse, N-Myc tag MG51444-NM
Bad qPCR Primer Pairs, Mouse MP201328

Bad cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Human HG10020-M
Bad cDNA ORF Clone, Human, untagged HG10020-UT
Bad cDNA ORF Clone, Human, C-GFPSpark® tag HG10020-ACG
Bad Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10020-ACGLN
Bad cDNA ORF Clone, Human, N-GFPSpark® tag HG10020-ANG
Bad cDNA ORF Clone, Human, C-OFPSpark® tag HG10020-ACR
Bad cDNA ORF Clone, Human, N-OFPSpark® tag HG10020-ANR
Bad cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10020-CF
Bad cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10020-NF
Bad cDNA ORF Clone, Human, C-His tag HG10020-CH
Bad cDNA ORF Clone, Human, N-His tag HG10020-NH
Bad cDNA ORF Clone, Human, N-HA tag HG10020-NY
Bad cDNA ORF Clone, Human, C-Myc tag HG10020-CM
Bad cDNA ORF Clone, Human, N-Myc tag HG10020-NM
Bad qPCR Primer Pairs, Human HP100117
info info
添加购物车成功! 添加购物车失败!