BACE2 cDNA ORF Clone, Human, N-His tag

Cat: HG10783-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BACE2 Reagents
CRO Services
Product recommended

All BACE2 Reagents
BACE2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1557 bp
Description
Full length Clone DNA of Human beta-site APP-cleaving enzyme 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BACE2 cDNA ORF Clone, Human, N-His tag Alternative Names
AEPLC cDNA ORF Clone, Human;ALP56 cDNA ORF Clone, Human;ASP1 cDNA ORF Clone, Human;ASP21 cDNA ORF Clone, Human;BAE2 cDNA ORF Clone, Human;CDA13 cDNA ORF Clone, Human;CEAP1 cDNA ORF Clone, Human;DRAP cDNA ORF Clone, Human
BACE2 Background Information

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

Full Name
beta-site APP-cleaving enzyme 2
References
  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • BACE2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BACE2 cDNA ORF Clone in Cloning Vector, Mouse MG51031-G
    BACE2 cDNA ORF Clone, Mouse, untagged MG51031-UT
    BACE2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51031-ACGLN
    BACE2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51031-ACG
    BACE2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51031-ACR
    BACE2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51031-CF
    BACE2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51031-NF
    BACE2 cDNA ORF Clone, Mouse, C-His tag MG51031-CH
    BACE2 cDNA ORF Clone, Mouse, N-His tag MG51031-NH
    BACE2 cDNA ORF Clone, Mouse, C-HA tag MG51031-CY
    BACE2 cDNA ORF Clone, Mouse, N-HA tag MG51031-NY
    BACE2 cDNA ORF Clone, Mouse, C-Myc tag MG51031-CM
    BACE2 cDNA ORF Clone, Mouse, N-Myc tag MG51031-NM
    BACE2 qPCR Primer Pairs, Mouse MP200990

    BACE2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BACE2 cDNA ORF Clone in Cloning Vector, Human HG10783-M
    BACE2 cDNA ORF Clone, Human, untagged HG10783-UT
    BACE2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10783-ACGLN
    BACE2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10783-ACG
    BACE2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10783-ACR
    BACE2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10783-CF
    BACE2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10783-NF
    BACE2 cDNA ORF Clone, Human, C-His tag HG10783-CH
    BACE2 cDNA ORF Clone, Human, C-HA tag HG10783-CY
    BACE2 cDNA ORF Clone, Human, N-HA tag HG10783-NY
    BACE2 cDNA ORF Clone, Human, C-Myc tag HG10783-CM
    BACE2 cDNA ORF Clone, Human, N-Myc tag HG10783-NM
    BACE2 qPCR Primer Pairs, Human HP100701
    info info
    添加购物车成功! 添加购物车失败!