Quick Order

Human BACE2 / Beta secretase 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BACE2 cDNA Clone Product Information
NCBI RefSeq:NM_012105.3
RefSeq ORF Size:1557bp
cDNA Description:Full length Clone DNA of Homo sapiens beta-site APP-cleaving enzyme 2.
Gene Synonym:ASP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-BACE2
Restriction Site:HindIII + XbaI (6.1kb + 1.56kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 84C>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BACE2 Gene Plasmid Map
Human BACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

References
  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • Size / Price
    Catalog: HG10783-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human BACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"