After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BACE1 transcript variant a Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human BACE1 cDNA Clone Product Information
NCBI RefSeq:AF190725
RefSeq ORF Size:1506bp
cDNA Description:Full length Clone DNA of Homo sapiens beta-site APP-cleaving enzyme 1 (BACE1), transcript variant a with C terminal Myc tag.
Gene Synonym:BACE1, ASP2, BACE, HSPC104, FLJ90568, KIAA1149
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells. In the brain, This protein is expressed highly in the substantia nigra, locus coruleus and medulla oblongata. Strong BACE1 expression has also been described in pancreatic tissue. BACE1 has a pivotal role in the pathogenesis of Alzheimer's disease. In Alzheimer's disease patients, BACE1 levels were elevated although mRNA levels were not changed. It has been found that BACE1 gene expression is controlled by a TATA-less promoter. The translational repression as a new mechanism controlling its expression. And the low concentrations of Ca(2+) (microM range) significantly increased the proteolytic activity of BACE1. Furthermore, BACE1 protein is ubiquitinated, and the degradation of BACE1 proteins and amyloid precursor protein processing are regulated by the ubiquitin-proteasome pathway. It has also been identified as the rate limiting enzyme for amyloid-beta-peptide (Abeta) production.

References
  • Christensen MA, et al. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol. 24(2):865-74.
  • Stockley JH, et al. (2007) The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans. 35(Pt 3): 574-6.
  • Savonenko AV, et al. (2008) Alteration of BACE1-dependent NRG1/ErbB4 signaling and schizophrenia-like phenotypes in BACE1-null mice. Proc Natl Acad Sci U S A. 105(14): 5585-90.
  • Hayley M, et al. (2009) Calcium enhances the proteolytic activity of BACE1: An in vitro biophysical and biochemical characterization of the BACE1-calcium interaction. Biochim Biophys Acta. 1788(9): 1933-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"