B3GNT6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13951-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All B3GNT6 Reagents
CRO Services
Product recommended

All B3GNT6 Reagents
B3GNT6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1155 bp
Description
Full length Clone DNA of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B3GNT6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
B3Gn-T6 cDNA ORF Clone, Human;beta-1,3-Gn-T6 cDNA ORF Clone, Human;beta3Gn-T6 cDNA ORF Clone, Human;BGnT-6 cDNA ORF Clone, Human
B3GNT6 Background Information

B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis of mucin-type O-glycans in digestive organs. It catalyzes the transfer of GlcNAc from UDP-GlcNAc to GalNAcalpha1-Ser/Thr (Tn antigen) to form the core 3 structure (GlcNAcbeta1-3GalNAcalpha1-Ser/Thr). Core 3 structure exists in O-glycan which is an important precursor in the biosynthesis of mucin-type glycoproteins. Loss of core 3 could lead to the production of secreted mucins, then bacteria would be inefficiently cleared from the system, and chronic inflammation would be developed, which eventually would result in development of cancer. B3GNT6 gene is a tumor suppressor gene.

Full Name
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6
References
  • Hennet T, et al. (1998) Genomic cloning and expression of three murine UDP-galactose: beta-N-acetylglucosamine beta1,3-galactosyltransferase genes. J Biol Chem. 273(1):58-65.
  • Kolbinger F, et al. (1998) Cloning of a human UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase catalyzing the formation of type 1 chains. J Biol Chem. 273(1): 433-40.
  • Henrissat B, et al. (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J. 326:929-39.
  • info info
    添加购物车成功! 添加购物车失败!