Quick Order

Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human ANGPTL4 cDNA Clone Product Information
NCBI RefSeq:NM_139314.1
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens angiopoietin-like 4, transcript variant 1 with N terminal HA tag.
Gene Synonym:NL2, ARP4, FIAF, PGAR, HFARP, pp1158, ANGPTL2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10563-ACG$225
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10563-ACR$225
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10563-CF$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10563-CH$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10563-CM$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10563-CY$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10563-M$75
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10563-M-F$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10563-NF$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10563-NH$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10563-NM$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10563-NY$195
Human ANGPTL4 / angiopoietin-like protein 4 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10563-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

References
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catalog: HG10563-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"