Angiopoietin-4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10293-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Angiopoietin-4 Reagents
CRO Services
Product recommended

All Angiopoietin-4 Reagents
Angiopoietin-4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1512 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiopoietin 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.53kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Angiopoietin-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-4 cDNA ORF Clone, Human, N-Myc tag Validated Images
Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
Angiopoietin-4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
AGP4 cDNA ORF Clone, Human;ANG-3 cDNA ORF Clone, Human;ANG4 cDNA ORF Clone, Human
Angiopoietin-4 Background Information
Full Name
angiopoietin 4
References
  • Grosios K, et al. (1999) Assignment of ANGPT4, ANGPT1, and ANGPT2 encoding angiopoietins 4, 1 and 2 to human chromosome bands 20p13, 8q22.3?q23 and 8p23.1, respectively, by in situ hybridization and radiation hybrid mapping. Cytogenet. Cell Genet. 84 (1-2): 118-20.
  • Yamakawa M, et al. (2004) Expression of angiopoietins in renal epithelial and clear cell carcinoma cells: regulation by hypoxia and participation in angiogenesis. Am J Physiol Renal Physiol. 287 (4): 649-57.
  • Oliner J, et al. (2004) Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell. 6 (5): 507-16.
  • Angiopoietin-4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-4 cDNA ORF Clone in Cloning Vector, Mouse MG51133-G
    Angiopoietin-4 cDNA ORF Clone, Mouse, untagged MG51133-UT
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51133-ACG
    Angiopoietin-4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51133-ACGLN
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51133-ACR
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51133-CF
    Angiopoietin-4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51133-NF
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-His tag MG51133-CH
    Angiopoietin-4 cDNA ORF Clone, Mouse, N-His tag MG51133-NH
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-HA tag MG51133-CY
    Angiopoietin-4 cDNA ORF Clone, Mouse, N-HA tag MG51133-NY
    Angiopoietin-4 cDNA ORF Clone, Mouse, C-Myc tag MG51133-CM
    Angiopoietin-4 cDNA ORF Clone, Mouse, N-Myc tag MG51133-NM

    Angiopoietin-4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-4 cDNA ORF Clone in Cloning Vector, Human HG10293-M
    Angiopoietin-4 cDNA ORF Clone, Human, untagged HG10293-UT
    Angiopoietin-4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10293-ACG
    Angiopoietin-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10293-ACGLN
    Angiopoietin-4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10293-ACR
    Angiopoietin-4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10293-CF
    Angiopoietin-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10293-NF
    Angiopoietin-4 cDNA ORF Clone, Human, C-His tag HG10293-CH
    Angiopoietin-4 cDNA ORF Clone, Human, N-His tag HG10293-NH
    Angiopoietin-4 cDNA ORF Clone, Human, C-HA tag HG10293-CY
    Angiopoietin-4 cDNA ORF Clone, Human, N-HA tag HG10293-NY
    Angiopoietin-4 cDNA ORF Clone, Human, C-Myc tag HG10293-CM
    Angiopoietin-4 qPCR Primer Pairs, Human HP100338
    info info
    添加购物车成功! 添加购物车失败!