Quick Order

Text Size:AAA

Human ANGPT4 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human ANGPT4 cDNA Clone Product Information
NCBI RefSeq:NM_015985.2
RefSeq ORF Size:1512bp
cDNA Description:Full length Clone DNA of Homo sapiens angiopoietin 4 with N terminal Myc tag.
Gene Synonym:AGP4, ANG4, ANG-3, MGC138181, MGC138183
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-ANGPT4
Restriction Site:KpnI + XbaI (6kb + 1.53kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ANGPT4 Gene Plasmid Map
Human Angiopoietin-4 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
References
  • Grosios K, et al. (1999) Assignment of ANGPT4, ANGPT1, and ANGPT2 encoding angiopoietins 4, 1 and 2 to human chromosome bands 20p13, 8q22.3?q23 and 8p23.1, respectively, by in situ hybridization and radiation hybrid mapping. Cytogenet. Cell Genet. 84 (1-2): 118-20.
  • Yamakawa M, et al. (2004) Expression of angiopoietins in renal epithelial and clear cell carcinoma cells: regulation by hypoxia and participation in angiogenesis. Am J Physiol Renal Physiol. 287 (4): 649-57.
  • Oliner J, et al. (2004) Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell. 6 (5): 507-16.
  • Size / Price
    Catalog: HG10293-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human Angiopoietin-4 natural ORF mammalian expression plasmid, N-Myc tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"