Quick Order

Human Adiponectin/Acrp30/ADIPOQ Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ADIPOQ cDNA Clone Product Information
NCBI RefSeq:NM_004797.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens adiponectin, C1Q and collagen domain containing with N terminal His tag.
Gene Synonym:ACDC, ADPN, APM1, APM-1, GBP28, ACRP30, adiponectin
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-ADIPOQ
Restriction Site:KpnI + XbaI (6kb + 0.77kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ADIPOQ Gene Plasmid Map
Human Acrp30 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Unlike other adipocytokines produced by adipose tissue, adiponectin appears to have anti-inflammatory, anti-diabetic, and anti-atherogenic properties. Several clinical studies demonstrate the inverse relationship between plasma adiponectin levels and several inflammatory markers including C-reactive protein. Adiponectin attenuates inflammatory responses to multiple stimuli by modulating signaling pathways in a variety of cell types. The anti-inflammatory properties of adiponectin may be a major component of its beneficial effects on cardiovascular and metabolic disorders including atherosclerosis and insulin resistance. Additionally, it is important factor in chronic liver diseases and chronic kidney diseases. Some cancer cell types express adiponectin receptors. Thus Adiponectin may act on tumour cells directly by binding and activating adiponectin receptors and downstream signalling pathways.

References
  • Cui J, et al. (2011) The role of adiponectin in metabolic and vascular disease: a review. Clin Nephrol. 75(1): 26-33.
  • Michalakis KG, et al. (2010) The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction. Fertil Steril. 94(6): 1949-57.
  • Dez JJ, et al.. (2010) The role of the novel adipocyte-derived protein adiponectin in human disease: an update. Mini Rev Med Chem. 10(9): 856-69.
  • Ouchi N, et al. (2007) Adiponectin as an anti-inflammatory factor. Clin Chim Acta. 380(1-2): 24-30.
  • Barb D, et al. (2006) Adiponectin: a link between obesity and cancer. Expert Opin Investig Drugs. 15(8): 917-31.
  • Size / Price
    Catalog: HG10772-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human Acrp30 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"