Aurora B cDNA ORF Clone, Human, N-His tag

Cat: HG11415-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Aurora B Reagents
CRO Services
Product recommended

All Aurora B Reagents
Aurora B cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Human urora kinase B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aurora B cDNA ORF Clone, Human, N-His tag Alternative Names
AIK2 cDNA ORF Clone, Human;AIM-1 cDNA ORF Clone, Human;AIM1 cDNA ORF Clone, Human;ARK2 cDNA ORF Clone, Human;AurB cDNA ORF Clone, Human;aurkb-sv1 cDNA ORF Clone, Human;aurkb-sv2 cDNA ORF Clone, Human;IPL1 cDNA ORF Clone, Human;PPP1R48 cDNA ORF Clone, Human;STK12 cDNA ORF Clone, Human;STK5 cDNA ORF Clone, Human
Aurora B Background Information

This Aurora B kinase gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The Aurora B kinase genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
aurora kinase B
References
  • Xavier de Carvalho A, Maiato H, Maia AF, et al. Reed-Sternberg Cells Form by Abscission Failure in the Presence of Functional Aurora B Kinase. Zhang L, ed. PLoS ONE. 2015;10(5):e0124629.
  • Aurora B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aurora B cDNA ORF Clone in Cloning Vector, Mouse MG53910-U
    Aurora B cDNA ORF Clone, Mouse, untagged MG53910-UT
    Aurora B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53910-ACG
    Aurora B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53910-ACGLN
    Aurora B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53910-ANG
    Aurora B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53910-ACR
    Aurora B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53910-ANR
    Aurora B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53910-CF
    Aurora B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53910-NF
    Aurora B cDNA ORF Clone, Mouse, C-His tag MG53910-CH
    Aurora B cDNA ORF Clone, Mouse, N-His tag MG53910-NH
    Aurora B cDNA ORF Clone, Mouse, C-HA tag MG53910-CY
    Aurora B cDNA ORF Clone, Mouse, N-HA tag MG53910-NY
    Aurora B cDNA ORF Clone, Mouse, C-Myc tag MG53910-CM
    Aurora B cDNA ORF Clone, Mouse, N-Myc tag MG53910-NM

    Aurora B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aurora B cDNA ORF Clone in Cloning Vector, Human HG11415-M
    Aurora B cDNA ORF Clone, Human, untagged HG11415-UT
    Aurora B cDNA ORF Clone, Human, C-GFPSpark® tag HG11415-ACG
    Aurora B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11415-ACGLN
    Aurora B cDNA ORF Clone, Human, N-GFPSpark® tag HG11415-ANG
    Aurora B cDNA ORF Clone, Human, C-OFPSpark® tag HG11415-ACR
    Aurora B cDNA ORF Clone, Human, N-OFPSpark® tag HG11415-ANR
    Aurora B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11415-CF
    Aurora B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11415-NF
    Aurora B cDNA ORF Clone, Human, C-His tag HG11415-CH
    Aurora B cDNA ORF Clone, Human, C-HA tag HG11415-CY
    Aurora B cDNA ORF Clone, Human, N-HA tag HG11415-NY
    Aurora B cDNA ORF Clone, Human, C-Myc tag HG11415-CM
    Aurora B cDNA ORF Clone, Human, N-Myc tag HG11415-NM
    Aurora B qPCR Primer Pairs, Human HP101293
    info info
    添加购物车成功! 添加购物车失败!