Aurora A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10669-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Aurora A Reagents
CRO Services
Product recommended

All Aurora A Reagents
Aurora A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1251 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human aurora kinase A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Aurora A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aurora A cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Aurora A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
AIK cDNA ORF Clone, Human;ARK1 cDNA ORF Clone, Human;AURA cDNA ORF Clone, Human;AURORA2 cDNA ORF Clone, Human;BTAK cDNA ORF Clone, Human;PPP1R47 cDNA ORF Clone, Human;STK15 cDNA ORF Clone, Human;STK6 cDNA ORF Clone, Human;STK7 cDNA ORF Clone, Human
Aurora A Background Information

The Aurora kinase A protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
aurora kinase A
References
  • Tamotsu K, Okumura H, Uchikado Y, et al. Correlation of Aurora-A expression with the effect of chemoradiation therapy on esophageal squamous cell carcinoma. BMC Cancer. 2015;15:323. doi:10.1186/s12885-015-1329-3.
  • info info
    添加购物车成功! 添加购物车失败!