SCA10/ATXN10 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14831-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SCA10/ATXN10 Reagents
CRO Services
Product recommended

All SCA10/ATXN10 Reagents
SCA10/ATXN10 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Human ataxin 10 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCA10/ATXN10 cDNA ORF Clone, Human, C-Myc tag Alternative Names
E46L cDNA ORF Clone, Human;HUMEEP cDNA ORF Clone, Human;SCA10 cDNA ORF Clone, Human
SCA10/ATXN10 Background Information
Full Name
ataxin 10

SCA10/ATXN10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SCA10/ATXN10 cDNA ORF Clone in Cloning Vector, Rat RG81478-G

SCA10/ATXN10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCA10/ATXN10 cDNA ORF Clone in Cloning Vector, Mouse MG51575-G
SCA10/ATXN10 cDNA ORF Clone, Mouse, untagged MG51575-UT
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51575-ACG
SCA10/ATXN10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51575-ACGLN
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51575-ANG
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51575-ACR
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51575-ANR
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51575-CF
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51575-NF
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-His tag MG51575-CH
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-His tag MG51575-NH
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-HA tag MG51575-CY
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-HA tag MG51575-NY
SCA10/ATXN10 cDNA ORF Clone, Mouse, C-Myc tag MG51575-CM
SCA10/ATXN10 cDNA ORF Clone, Mouse, N-Myc tag MG51575-NM
SCA10/ATXN10 qPCR Primer Pairs, Mouse MP201458

SCA10/ATXN10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCA10/ATXN10 cDNA ORF Clone in Cloning Vector, Human HG14831-G
SCA10/ATXN10 cDNA ORF Clone, Human, untagged HG14831-UT
SCA10/ATXN10 cDNA ORF Clone, Human, C-GFPSpark® tag HG14831-ACG
SCA10/ATXN10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14831-ACGLN
SCA10/ATXN10 cDNA ORF Clone, Human, N-GFPSpark® tag HG14831-ANG
SCA10/ATXN10 cDNA ORF Clone, Human, C-OFPSpark® tag HG14831-ACR
SCA10/ATXN10 cDNA ORF Clone, Human, N-OFPSpark® tag HG14831-ANR
SCA10/ATXN10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14831-CF
SCA10/ATXN10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14831-NF
SCA10/ATXN10 cDNA ORF Clone, Human, C-His tag HG14831-CH
SCA10/ATXN10 cDNA ORF Clone, Human, N-His tag HG14831-NH
SCA10/ATXN10 cDNA ORF Clone, Human, C-HA tag HG14831-CY
SCA10/ATXN10 cDNA ORF Clone, Human, N-HA tag HG14831-NY
SCA10/ATXN10 cDNA ORF Clone, Human, N-Myc tag HG14831-NM
SCA10/ATXN10 qPCR Primer Pairs, Human HP103462
info info
添加购物车成功! 添加购物车失败!