ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13997-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATPase Inhibitory Factor 1 Reagents
CRO Services
Product recommended

All ATPase Inhibitory Factor 1 Reagents
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
321 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ATPase inhibitory factor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.37kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ATPase Inhibitory Factor 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human ATPase Inhibitory Factor 1 Gene Expression validated Image 1973
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ATPI cDNA ORF Clone, Human;ATPIP cDNA ORF Clone, Human;IP cDNA ORF Clone, Human
ATPase Inhibitory Factor 1 Background Information
Full Name
ATPase inhibitory factor 1

ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATPase Inhibitory Factor 1 cDNA ORF Clone in Cloning Vector, Mouse MG51315-U
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, untagged MG51315-UT
ATPase Inhibitory Factor 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51315-ACGLN
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51315-ACG
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51315-ANG
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51315-ACR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51315-ANR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51315-CF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51315-NF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-His tag MG51315-CH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-His tag MG51315-NH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-HA tag MG51315-CY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-HA tag MG51315-NY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-Myc tag MG51315-CM
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-Myc tag MG51315-NM
ATPase Inhibitory Factor 1 qPCR Primer Pairs, Mouse MP201192

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATPase Inhibitory Factor 1 cDNA ORF Clone in Cloning Vector, Human HG13997-G
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, untagged HG13997-UT
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13997-ACG
ATPase Inhibitory Factor 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13997-ACGLN
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13997-ANG
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13997-ACR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13997-ANR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13997-NF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-His tag HG13997-CH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag HG13997-NH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-HA tag HG13997-CY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-HA tag HG13997-NY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-Myc tag HG13997-CM
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-Myc tag HG13997-NM
ATPase Inhibitory Factor 1 qPCR Primer Pairs, Human HP102653
info info
添加购物车成功! 添加购物车失败!