ATP6V1D/Atp6m cDNA ORF Clone, Human, N-His tag

Cat: HG14297-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATP6V1D/Atp6m Reagents
CRO Services
Product recommended

All ATP6V1D/Atp6m Reagents
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V1D/Atp6m cDNA ORF Clone, Human, N-His tag Alternative Names
ATP6M cDNA ORF Clone, Human;VATD cDNA ORF Clone, Human;VMA8 cDNA ORF Clone, Human
ATP6V1D/Atp6m Background Information
Full Name
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D

ATP6V1D/Atp6m cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V1D/Atp6m cDNA ORF Clone in Cloning Vector, Rat RG81207-U
ATP6V1D/Atp6m cDNA ORF Clone, Rat, untagged RG81207-UT
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-GFPSpark® tag RG81207-ACG
ATP6V1D/Atp6m Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81207-ACGLN
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-OFPSpark® tag RG81207-ACR
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81207-CF
ATP6V1D/Atp6m cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81207-NF
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-His tag RG81207-CH
ATP6V1D/Atp6m cDNA ORF Clone, Rat, N-His tag RG81207-NH
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-HA tag RG81207-CY
ATP6V1D/Atp6m cDNA ORF Clone, Rat, N-HA tag RG81207-NY
ATP6V1D/Atp6m cDNA ORF Clone, Rat, C-Myc tag RG81207-CM
ATP6V1D/Atp6m cDNA ORF Clone, Rat, N-Myc tag RG81207-NM
ATP6V1D/Atp6m qPCR Primer Pairs, Rat RP301163

ATP6V1D/Atp6m cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP6V1D/Atp6m cDNA ORF Clone in Cloning Vector, Mouse MG51771-U
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, untagged MG51771-UT
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51771-ACG
ATP6V1D/Atp6m Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51771-ACGLN
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51771-ANG
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51771-ACR
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51771-ANR
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51771-CF
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51771-NF
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-His tag MG51771-CH
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-His tag MG51771-NH
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-HA tag MG51771-CY
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-HA tag MG51771-NY
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, C-Myc tag MG51771-CM
ATP6V1D/Atp6m cDNA ORF Clone, Mouse, N-Myc tag MG51771-NM
ATP6V1D/Atp6m qPCR Primer Pairs, Mouse MP201644

ATP6V1D/Atp6m cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V1D/Atp6m cDNA ORF Clone in Cloning Vector, Human HG14297-G
ATP6V1D/Atp6m cDNA ORF Clone, Human, untagged HG14297-UT
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-GFPSpark® tag HG14297-ACG
ATP6V1D/Atp6m Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14297-ACGLN
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-GFPSpark® tag HG14297-ANG
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-OFPSpark® tag HG14297-ACR
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-OFPSpark® tag HG14297-ANR
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14297-CF
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14297-NF
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-His tag HG14297-CH
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-HA tag HG14297-CY
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-HA tag HG14297-NY
ATP6V1D/Atp6m cDNA ORF Clone, Human, C-Myc tag HG14297-CM
ATP6V1D/Atp6m cDNA ORF Clone, Human, N-Myc tag HG14297-NM
ATP6V1D/Atp6m qPCR Primer Pairs, Human HP102947
info info
添加购物车成功! 添加购物车失败!