ATP5J cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15143-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5J Reagents
CRO Services
Product recommended

All ATP5J Reagents
ATP5J cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5J cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ATP5 cDNA ORF Clone, Human;ATP5A cDNA ORF Clone, Human;ATPM cDNA ORF Clone, Human;CF6 cDNA ORF Clone, Human;F6 cDNA ORF Clone, Human
ATP5J Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6

ATP5J cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5J cDNA ORF Clone in Cloning Vector, Mouse MG52704-G
ATP5J cDNA ORF Clone, Mouse, untagged MG52704-UT
ATP5J Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52704-ACGLN
ATP5J cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52704-ACG
ATP5J cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52704-ANG
ATP5J cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52704-ACR
ATP5J cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52704-ANR
ATP5J cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52704-CF
ATP5J cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52704-NF
ATP5J cDNA ORF Clone, Mouse, C-His tag MG52704-CH
ATP5J cDNA ORF Clone, Mouse, N-His tag MG52704-NH
ATP5J cDNA ORF Clone, Mouse, C-HA tag MG52704-CY
ATP5J cDNA ORF Clone, Mouse, N-HA tag MG52704-NY
ATP5J cDNA ORF Clone, Mouse, C-Myc tag MG52704-CM
ATP5J cDNA ORF Clone, Mouse, N-Myc tag MG52704-NM
ATP5J qPCR Primer Pairs, Mouse MP202575

ATP5J cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5J cDNA ORF Clone in Cloning Vector, Human HG15143-G
ATP5J cDNA ORF Clone, Human, untagged HG15143-UT
ATP5J cDNA ORF Clone, Human, C-GFPSpark® tag HG15143-ACG
ATP5J Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15143-ACGLN
ATP5J cDNA ORF Clone, Human, N-GFPSpark® tag HG15143-ANG
ATP5J cDNA ORF Clone, Human, C-OFPSpark® tag HG15143-ACR
ATP5J cDNA ORF Clone, Human, N-OFPSpark® tag HG15143-ANR
ATP5J cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15143-CF
ATP5J cDNA ORF Clone, Human, C-His tag HG15143-CH
ATP5J cDNA ORF Clone, Human, N-His tag HG15143-NH
ATP5J cDNA ORF Clone, Human, C-HA tag HG15143-CY
ATP5J cDNA ORF Clone, Human, N-HA tag HG15143-NY
ATP5J cDNA ORF Clone, Human, C-Myc tag HG15143-CM
ATP5J cDNA ORF Clone, Human, N-Myc tag HG15143-NM
ATP5J qPCR Primer Pairs, Human HP103770
info info
添加购物车成功! 添加购物车失败!