ATP5A1 cDNA ORF Clone, Human, untagged

Cat: HG14419-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5A1 Reagents
CRO Services
Product recommended

All ATP5A1 Reagents
ATP5A1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1662 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI(6kb+1.66kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ATP5A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5A1 cDNA ORF Clone, Human, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
ATP5A1 cDNA ORF Clone, Human, untagged Alternative Names
ATP5A cDNA ORF Clone, Human;ATP5AL2 cDNA ORF Clone, Human;ATPM cDNA ORF Clone, Human;COXPD22 cDNA ORF Clone, Human;hATP1 cDNA ORF Clone, Human;HEL-S-123m cDNA ORF Clone, Human;MC5DN4 cDNA ORF Clone, Human;MOM2 cDNA ORF Clone, Human;OMR cDNA ORF Clone, Human;ORM cDNA ORF Clone, Human
ATP5A1 Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

ATP5A1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Rhesus CG90790-G
ATP5A1 cDNA ORF Clone, Rhesus, untagged CG90790-UT
ATP5A1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90790-ACGLN
ATP5A1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90790-ACG
ATP5A1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90790-ANG
ATP5A1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90790-ACR
ATP5A1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90790-ANR
ATP5A1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90790-CF
ATP5A1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90790-NF
ATP5A1 cDNA ORF Clone, Rhesus, C-His tag CG90790-CH
ATP5A1 cDNA ORF Clone, Rhesus, N-His tag CG90790-NH
ATP5A1 cDNA ORF Clone, Rhesus, C-HA tag CG90790-CY
ATP5A1 cDNA ORF Clone, Rhesus, N-HA tag CG90790-NY
ATP5A1 cDNA ORF Clone, Rhesus, C-Myc tag CG90790-CM
ATP5A1 cDNA ORF Clone, Rhesus, N-Myc tag CG90790-NM

ATP5A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Rat RG80909-U
ATP5A1 cDNA ORF Clone, Rat, untagged RG80909-UT
ATP5A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80909-ACGLN
ATP5A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80909-ACG
ATP5A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80909-ANG
ATP5A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80909-ACR
ATP5A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80909-ANR
ATP5A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80909-CF
ATP5A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80909-NF
ATP5A1 cDNA ORF Clone, Rat, C-His tag RG80909-CH
ATP5A1 cDNA ORF Clone, Rat, N-His tag RG80909-NH
ATP5A1 cDNA ORF Clone, Rat, C-HA tag RG80909-CY
ATP5A1 cDNA ORF Clone, Rat, N-HA tag RG80909-NY
ATP5A1 cDNA ORF Clone, Rat, C-Myc tag RG80909-CM
ATP5A1 cDNA ORF Clone, Rat, N-Myc tag RG80909-NM
ATP5A1 qPCR Primer Pairs, Rat RP300873

ATP5A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59917-CF

ATP5A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Human HG14419-G
ATP5A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14419-ACGLN
ATP5A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14419-ACG
ATP5A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14419-ANG
ATP5A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14419-ACR
ATP5A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14419-ANR
ATP5A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14419-CF
ATP5A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14419-NF
ATP5A1 cDNA ORF Clone, Human, C-His tag HG14419-CH
ATP5A1 cDNA ORF Clone, Human, N-His tag HG14419-NH
ATP5A1 cDNA ORF Clone, Human, C-HA tag HG14419-CY
ATP5A1 cDNA ORF Clone, Human, N-HA tag HG14419-NY
ATP5A1 cDNA ORF Clone, Human, C-Myc tag HG14419-CM
ATP5A1 cDNA ORF Clone, Human, N-Myc tag HG14419-NM
ATP5A1 qPCR Primer Pairs, Human HP103068
info info
添加购物车成功! 添加购物车失败!