After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ATP1B4 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ATP1B4 cDNA Clone Product Information
NCBI RefSeq:NM_001142447.2
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Homo sapiens ATPase, Na+/K+ transporting, beta 4 polypeptide with N terminal His tag.
Gene Synonym:ATP1B4
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ATP1B4 is a member of the X(+)/potassium ATPases subunit beta family. It is highly expressed in skeletal muscle and at a lower level in heart. ATP1B4 gene can be found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na, K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. ATP1B4 may act as a transcriptional coregulator during muscle development through its interaction with SNW1. Na+, K+-ATPase is an important regulator of intracellular electrolyte levels in most mammalian cells. It is a Mg2+-dependent transport pump responsible for maintaining the low intracellular Na+:K+ ratio that is essential for cell homeostasis and physiological function. It catalyzes the active uptake of K+ and extrusion of Na+ at the expense of hydrolyzing ATP with a stoichiometry of 3 Na+ for 2 K+. ATP1B4 has lost its ancestral function as a Na,K-ATPase beta-subunit.

References
  • Pestov NB. et al., 2007, Proc Natl Acad Sci. 104 (27): 11215-20.
  • Kung AW. et al., 2006, Clin Endocrinol. 64 (2): 158-61.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog: HG13027-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"